Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU021061

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX9

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT

Ensembl | Número de adesão de ser humano

ENSG00000125398

nº de adesão NCBI

NM_000346

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SOX9(6662) , SOX9(6662)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Haiyun Luo et al.
Journal of endodontics, 44(5), 792-799 (2018-03-25)
The process of pulpitis is characterized by extracellular matrix imbalance and inflammatory cell infiltration. As an essential transcription factor, sex-determining region Y-box 9 (SOX9) is significantly inhibited by tumor necrosis factor alpha in inflammatory joint diseases. The aim of this
Jing Wang et al.
Oncotarget, 8(1), 574-582 (2016-11-24)
Cisplatin-based chemotherapy is the most commonly used treatment regimen for gastric cancer (GC), however, the resistance to cisplatin represents the key limitation for the therapeutic efficacy. Aberrant expression of MiR-524-5p appears to be involves in tumorigenesis and chemoresistance. However, the
Xiuyu Wang et al.
Biochemical and biophysical research communications, 516(1), 236-244 (2019-06-22)
The malignant proliferation is one of the major characteristic for tumor cells, however the mechanism of lung cancer cells uncontrollable proliferation is still confusing. This study investigated the mechanism of up-regulated FOXA1 in lung cancer and its tumorigenic function in
C-Q Liu et al.
European review for medical and pharmacological sciences, 23(13), 5628-5639 (2019-07-13)
The aim of the current study was to investigate the potential roles of miR-215-3p in the progression of cervical cancer. The levels of miR-215-3p in both cervical cancer tissues and cell lines were detected using quantitative Real-time polymerase chain reaction
J-C Shang et al.
European review for medical and pharmacological sciences, 23(14), 6160-6169 (2019-08-01)
Gastric cancer is one of the most common gastrointestinal malignancy, which is often diagnosed at an advanced stage. MicroRNA-105 (miR-105) was downregulated and acts as a tumor suppressor in various cancers. The purpose of this study was to explore the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica