Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU018671

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGGAGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGATGAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAAACCATCCAGCATCCACCAAGTAATCGTGCATCG

Ensembl | Número de adesão de ser humano

ENSG00000141646

nº de adesão NCBI

NM_005359

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SMAD4(4089) , SMAD4(4089)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ryotaro Ogawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(9), 2887-2899 (2019-02-02)
SMAD4 is a key transcriptional factor of TGFβ signaling and acts as a tumor suppressor in colorectal cancer. In the present study, we explored the immunologic effect of SMAD4 on the tumor microenvironment. Using 99 clinical specimens and human colorectal
Danyang Chao et al.
Biochemical and biophysical research communications, 509(2), 535-540 (2019-01-02)
AZD3759 is a tyrosine kinase inhibitor and has an encouraging future in treating brain metastases of non-small cell lung cancer. Here, we determined that AZD3759 suppressed the viability of HepG2 cells, a hepatoma cell line, and induced their apoptosis, suggesting
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Roxana Ola et al.
Circulation, 138(21), 2379-2394 (2018-07-07)
Hereditary hemorrhagic telangiectasia (HHT) is an inherited vascular disorder that causes arteriovenous malformations (AVMs). Mutations in the genes encoding Endoglin ( ENG) and activin-receptor-like kinase 1 ( AVCRL1 encoding ALK1) cause HHT type 1 and 2, respectively. Mutations in the
Qing Xie et al.
Scientific reports, 7, 42840-42840 (2017-02-17)
Increasing evidence has indicated that bone morphogenetic protein 2 (BMP2) coordinates with microRNAs (miRNAs) to form intracellular networks regulating mesenchymal stem cells (MSCs) osteogenesis. This study aimed to identify specific miRNAs in rat adipose-derived mesenchymal stem cells (ADSCs) during BMP2-induced
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica