Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

Outros documentos

EHU018071

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCTGGCAGTACCCTCTTATATATGGACTGATTCTTATTCCCTGCTGGTGTTCTCTAGTTTGCCTAAGTAGAATTTACATGGGAATGCACTCTATTCTGGATATTATTGCTGGATTCCTATATACCATTTTAATCTTAGCTGTCTTCTATCCATTTGTGGACCTGATTGACAACTTCAACCAAACTCACAAATATGCTCCATTCATCATCATCGGGCTTCATTTAGCTTTGGGGATCTTTTCTTTCACTCTTGACACCTGGAGCACATCCCGAGGAGACACAGCCGAGATACTAGGAAGTGGTGCTGGAATTGCATGTGGATCTCATGTTACTTATAACATGGGTCTAGTATTAGATCCTTCTCTAGATACATTACCTTTAGCTGGGCCCCCCATTACTGTGACTCTGTTTGGAAAAGCCATATTGCGGATCCTCATAGGGATGGTATTTGTACTAATAATCAGAGATGTAATGAAAAAGATCACCATTCCTTTAGCCTGCAAA

Ensembl | Número de adesão de ser humano

ENSG00000126821

nº de adesão NCBI

NM_030791

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SGPP1(81537) , SGPP1(81537)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica