Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU017831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOS1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCCACAGTTGAGTGGCATATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACACCCAATAGAAATTGCTCGACAACTCACTTTACTTGAATCAGATCTATACCGAGCTGTACAGCCATCAGAATTAGTTGGAAGTGTGTGGACAAAAGAAGACAAAGAAATTAACTCTCCTAATCTTCTGAAAATGATTCGACATACCACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTAGAAACTGAAAATTTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAAGTCTTTCAAGAGTTGAACAACTTTAATGGTGTCCTTGAGGTTGTCAGTGCTATGAATTCATCACCTGTTTACAGACTAGACCACACATTTGAGCAAATACCAAGTCGCCAGAAGAAAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Manish Mishra et al.
Antioxidants & redox signaling, 30(13), 1621-1634 (2018-08-15)
Diabetes increases oxidative stress in the retina and dysfunctions their mitochondria, accelerating capillary cell apoptosis. A 66 kDa adaptor protein, p66Shc, is considered as a sensor of oxidative stress-induced apoptosis. In the pathogenesis of diabetic retinopathy, a progressive disease, reactive oxygen
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica