Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU016511

Sigma-Aldrich

MISSION® esiRNA

targeting human CHN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT

Ensembl | Número de adesão de ser humano

ENSG00000128656

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CHN1(1123) , CHN1(1123)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhuomin Wu et al.
Molecular neurobiology, 54(10), 7670-7685 (2016-11-16)
In recent years, long noncoding RNAs (lncRNAs) have been shown to have critical roles in a broad range of cell biological processes. However, the activities of lncRNAs during ischemic stroke remain largely unknown. In this study, we carried out a
Wenke Zhao et al.
Cancer medicine (2018-05-31)
It has been verified that long noncoding RNAs (lncRNAs) have great effects on various biological behaviors of human diseases. Although more and more lncRNAs have been studied in human cancers, countless lncRNAs still need to be excavated. This study aims
Chunfeng Pan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 339-352 (2017-08-31)
Recently, long non-coding RNAs (lncRNAs) have been found to have many biological effects in different cancer stages. Several studies have revealed that focally amplified lncRNA on chromosome 1 (FAL1) regulates cancer progression via p21. However, the expression and mechanism of
Chingli Lee et al.
Scientific reports, 7, 43651-43651 (2017-03-08)
Fyn tyrosine kinase has been implicated in the pathogenesis of Alzheimer's disease (AD). We have previously reported that upregulation of the FynT isoform in AD brains was partly associated with astrocyte activation. In this study, we demonstrated selective FynT induction
Guang Yang et al.
Immunology, 153(1), 105-117 (2017-08-24)
The B-lymphocyte-induced maturation protein 1 (Blimp1) regulates T-cell homeostasis and function. Loss of Blimp1 could double the proportion of follicular regulatory T (Tfr) cells. However, the effects that Blimp1 may have on the function of Tfr cells remain unknown. Here
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica