Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU015351

Sigma-Aldrich

MISSION® esiRNA

targeting human AIM2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGTGTCTGCAGTGATGAAGACCATTCGTATTTTTCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGATAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTTTCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGACCCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTTTGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAATAGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTG

Ensembl | Número de adesão de ser humano

ENSG00000163568

nº de adesão NCBI

NM_004833

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AIM2(9447) , AIM2(9447)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

N Yoon et al.
Cell death & disease, 7, e2191-e2191 (2016-04-15)
Our recent study showed that human mesenchymal stem/stromal cells (hMSCs) are activated to express tumor necrosis factor (TNF)-α-related apoptosis-inducing ligand (TRAIL) by exposure to TNF-α and these activated hMSCs effectively induce apoptosis in triple-negative breast cancer MDA-MB-231 (MDA) cells in
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Yunjia Yang et al.
Journal of cellular biochemistry, 120(10), 17744-17756 (2019-06-19)
Absent in melanoma 2 (AIM2) is a critical component in natural immunity system and is closely related to cancer initiation and development. It has been shown that AIM2 inhibited colorectal cancer (CRC) development and cell proliferation. It remains unresolved how
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Mehdi Farshchian et al.
Oncotarget, 8(28), 45825-45836 (2017-05-21)
Cutaneous squamous cell carcinoma (cSCC) is the most common metastatic skin cancer. Inflammation is a typical feature in cSCC progression. Analysis of the expression of inflammasome components in cSCC cell lines and normal human epidermal keratinocytes revealed upregulation of the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica