Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU014951

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRD1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAATCAGAGAGATTCCAAGAAATATAGGAGAATTGAGAAATTTGGTTAGTTTACATGCATACAATAATCAAATAAGTTATCTTCCACCATCTTTGCTATCTTTAAATGATCTGCAGCAACTAAACCTGAGTGGAAATAATCTGACAGCTCTACCTAGTGCTATCTACAATATTTTTTCACTGAAGGAGATAAATTTTGATGACAACCCTTTGCTGAGACCTCCAGTGGAAATCTGTAAAGGAAAACAGTTGTATACTATTGCACGCTATCTACAGAGGGCAGATGAAAGAGATGAGAAAATTTTAGAGAAGATATTCAAGATAGTTGCCAACAACATCACTGAAACCAATTTTGAATTTTTATGTCAAAAACTAAACCTGGCAAACTCAGAAACTGATATGCCTACAAAGAGCACTGTTTCATTAAGTGAGAGAGCCCACCAAGCACTTGTTATATGGAAAACACAAAGTAACAAGTTATCACTAACTGCTGCTGCTTTAAGAGATCA

Ensembl | Número de adesão de ser humano

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Alexander J A Deutsch et al.
Cancer research, 77(9), 2375-2386 (2017-03-03)
Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
Xiao-Jun Feng et al.
British journal of pharmacology, 172(11), 2852-2863 (2015-01-28)
The orphan nuclear receptor NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, and is involved in glucose and fat metabolism. However, its potential contribution to cardiovascular diseases remains to be assessed. Here, the roles of NOR1

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica