Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU013431

Sigma-Aldrich

MISSION® esiRNA

targeting human RAD18

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGCAGGGGAGCAGGTTAATGGATAATTTCTTGATCAGAGAAATGAGTGGTTCTACATCAGAGTTGTTGATAAAAGAAAATAAAAGCAAATTCAGCCCTCAAAAAGAGGCGAGCCCTGCTGCAAAGACCAAAGAGACACGTTCTGTAGAAGAGATCGCTCCAGATCCCTCAGAGGCTAAGCGTCCTGAGCCACCCTCGACATCCACTTTGAAACAAGTTACTAAAGTGGATTGTCCTGTTTGCGGGGTTAACATTCCAGAAAGTCACATTAATAAGCATTTAGACAGCTGTTTATCACGCGAAGAGAAGAAGGAAAGCCTCAGAAGTTCTGTTCACAAAAGGAAGCCGCTGCCCAAAACTGTATATAATTTGCTCTCTGATCGTGATTTAAAGAAAAAGCTAAAAGAGCATGGATTATCTATTCAAGGAAATAAACAACAGCTCATTAAAAGGCACCAAGAATTTGTACACATGTACAATGCCCAATGCGATGCTTTGCATCCTAAATCAGCTGC

Ensembl | Número de adesão de ser humano

ENSG00000070950

nº de adesão NCBI

NM_020165

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RAD18(56852) , RAD18(56852)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chen Xie et al.
Journal of cellular physiology, 234(11), 21100-21112 (2019-05-14)
This study aimed at investigating the role of RAD18 in the regulation of glioblastoma development as well as the underlying mechanisms. The human glioblastoma U251 and U87MG cells were transfected with siRNAs specifically targeting RAD18, and the effects of knockdown
Megumi Sasatani et al.
PloS one, 10(2), e0117845-e0117845 (2015-02-13)
The ubiquitin ligase RAD18 is involved in post replication repair pathways via its recruitment to stalled replication forks, and its role in the ubiquitylation of proliferating cell nuclear antigen (PCNA). Recently, it has been reported that RAD18 is also recruited
Thomas Göhler et al.
The Journal of cell biology, 192(2), 219-227 (2011-01-19)
DNA polymerase η (polη) belongs to the Y-family of DNA polymerases and facilitates translesion synthesis past UV damage. We show that, after UV irradiation, polη becomes phosphorylated at Ser601 by the ataxia-telangiectasia mutated and Rad3-related (ATR) kinase. DNA damage-induced phosphorylation
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica