Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU012621

Sigma-Aldrich

MISSION® esiRNA

targeting human POLD3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACC

Ensembl | Número de adesão de ser humano

ENSG00000077514

nº de adesão NCBI

NM_006591

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... POLD3(10714) , POLD3(10714)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Emanuela Tumini et al.
Scientific reports, 6, 38873-38873 (2016-12-16)
DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol
Xianning Lai et al.
Nature communications, 8, 15983-15983 (2017-07-18)
Failure to restart replication forks stalled at genomic regions that are difficult to replicate or contain endogenous DNA lesions is a hallmark of BRCA2 deficiency. The nucleolytic activity of MUS81 endonuclease is required for replication fork restart under replication stress
Robert L Dilley et al.
Nature, 539(7627), 54-58 (2016-11-04)
Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica