Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU012341

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGATTAAGAGAAATGAGCACGCATGGAAAAGTTTCCCAGTCTTCAGCAGAGAAGTTTTCTGGAGGTCTCTGAACCCAGGGAAGACAAGAAGGAAAGATTTTGTTGTTGTTTGTTTATTTGTTTTTCCAGTAGTTAGCTTTCTTCCTGGATTCCTCACTTTGAAGAGTGTGAGGAAAACCTATGTTTGCCGCTTAAGCTTTCAGCTCAGCTAATGAAGTGTTTAGCATAGTACCTCTGCTATTTGCTGTTATTTTATCTGCTATGCTATTGAAGTTTTGGCAATTGACTATAGTGTGAGCCAGGAATCACTG

Ensembl | Número de adesão de ser humano

ENSG00000163735

nº de adesão NCBI

NM_002994

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CXCL5(6374) , CXCL5(6374)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhijie Dai et al.
Oncology reports, 36(6), 3303-3310 (2016-10-18)
CXCL5 and its receptor CXCR2 have been found to be involved in tumorigenesis and cancer progression. Recent studies have shown that CXCR2 is upregulated in glioma tissues, and associated with poor prognosis and recurrence. However, the role of CXCL5/CXCR2 signaling in
Hongsheng Dang et al.
Oncology research, 25(2), 177-186 (2017-03-10)
CXCL5, a CXC-type chemokine, is an important attractant for granulocytic immune cells by binding to its receptor CXCR2. Recently, CXCL5/CXCR2 has been found to play an oncogenic role in many human cancers. However, the exact role of CXCL5 in osteosarcoma
Toshiyuki Mitsuyama et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 15(3), 271-280 (2015-03-31)
Characteristics of type 2 autoimmune pancreatitis (AIP) is granulocyte epithelial lesions, called idiopathic duct-centric pancreatitis (IDCP). To clarify pathogenesis of IDCP, we investigated mechanism of neutrophil infiltration in type 1 AIP, called lymphoplasmacytic sclerosing pancreatitis (LPSP) and IDCP. This study

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica