Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU011991

Sigma-Aldrich

MISSION® esiRNA

targeting human FER

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACACCTCATCATGGACACGCTACTTTAGCTAAGGCATGACCAGCAATGAACAGTAGTAAGATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAATGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGGAATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAGAATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAATGAATTATGTCAGCAACGTATCCAAGTCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCAGAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Joanna Stanicka et al.
Oncogene, 37(23), 3131-3150 (2018-03-16)
IGF-1 receptor (IGF-1R) and integrin cooperative signaling promotes cancer cell survival, proliferation, and motility, but whether this influences cancer progression and therapy responses is largely unknown. Here we investigated the non-receptor tyrosine adhesion kinase FES-related (FER), following its identification as

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica