Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU011461

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCC

Ensembl | Número de adesão de ser humano

ENSG00000125378

nº de adesão NCBI

NM_001202
NM_130850
NM_130851

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BMP4(652) , BMP4(652)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Janice Siu Chong Wong et al.
Experimental eye research, 181, 185-189 (2019-02-06)
Periorbital adipose tissue expansion is a key pathological change in thyroid associated orbitopathy (TAO). Bone morphogenic protein 4 (BMP4) is instrumental in adipogenesis. We compared site-specific BMP4 expression and its effect on adipogenesis using donor-matched adipose tissue-derived stromal cells (ADSC)
Thomas Helbing et al.
Inflammation, 40(6), 1862-1874 (2017-07-30)
Leukocyte recruitment is a fundamental event in the response of the innate immune system to injury. This process is promoted in part by the opening of endothelial cell adherens junctions that allows leukocyte extravasation through gaps between adjacent endothelial cells.
Xiaoqing Zhang et al.
Cell death discovery, 7(1), 51-51 (2021-03-17)
Alzheimer's disease (AD) is a chronic progressive degenerative disease of the nervous system. Its pathogenesis is complex and is related to the abnormal expression of the amyloid β (Aβ), APP, and Tau proteins. Evidence has demonstrated that bone morphogenetic protein
Thomas Helbing et al.
Inflammation, 40(2), 442-453 (2016-12-21)
The endothelium serves as a selective barrier and controls the exchange of nutrients, hormones, and leukocytes between blood and tissues. Molecular mechanisms contributing to the pathogenesis of endothelial barrier dysfunction remain incompletely understood. Accumulating evidence implicates bone morphogenetic protein (BMP)-modulator
Huiming Ju et al.
Molecular medicine reports, 13(3), 2194-2200 (2016-01-20)
MicroRNA-378 (miRNA-378) has been reported to have a crucial role in skeletal muscle differentiation; however, the underlying mechanisms have largely remained to be elucidated. The present study employed high‑throughput RNA sequencing to investigate the transcriptome following transfection of miRNA‑378 mimics
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica