Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU010991

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC1A3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCTCCTTTCCTGGGGAACTTCTGATGAGGATGTTACAGATGCTGGTCTTACCACTTATCATCTCCAGTCTTGTCACAGGAATGGCGGCGCTAGATAGTAAGGCATCAGGGAAGATGGGAATGCGAGCTGTAGTCTATTATATGACTACCACCATCATTGCTGTGGTGATTGGCATAATCATTGTCATCATCATCCATCCTGGGAAGGGCACAAAGGAAAACATGCACAGAGAAGGCAAAATTGTACGAGTGACAGCTGCAGATGCCTTCCTGGACTTGATCAGGAACATGTTCCCTCCAAATCTGGTAGAAGCCTGCTTTAAACAGTTTAAAACCAACTATGAGAAGAGAAGCTTTAAAGTGCCCATCCAGGCCAACGAAACGCTTGTGGGTGCTGTGATAAACAATGTGTCTGAGGCCATGGAGACTCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hirofumi Nagao et al.
The Journal of biological chemistry, 292(11), 4469-4483 (2017-01-26)
Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and
Thomas Bertero et al.
Cell metabolism, 29(1), 124-140 (2018-10-09)
Dysregulation of extracellular matrix (ECM) deposition and cellular metabolism promotes tumor aggressiveness by sustaining the activity of key growth, invasion, and survival pathways. Yet mechanisms by which biophysical properties of ECM relate to metabolic processes and tumor progression remain undefined.
Mylène Tajan et al.
Cell metabolism, 28(5), 721-736 (2018-08-21)
Numerous mechanisms to support cells under conditions of transient nutrient starvation have been described. Several functions of the tumor-suppressor protein p53 can contribute to the adaptation of cells to metabolic stress and help cancer cell survival under nutrient-limiting conditions. We

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica