Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU010511

Sigma-Aldrich

MISSION® esiRNA

targeting human VANGL2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGGAAGAGGAGCAGAAAAACCCCAGGGAGGTGATGGACCCCCGGGAGGCAGCCCAAGCCATCTTTGCATCCATGGCCCGTGCCATGCAGAAGTACCTTCGGACCACCAAGCAGCAGCCCTACCACACCATGGAGAGCATCCTGCAGCACCTTGAATTCTGCATCACGCATGACATGACGCCCAAGGCCTTCTTGGAGCGATACTTGGCGGCTGGACCTACCATCCAGTACCACAAGGAACGCTGGCTGGCCAAACAGTGGACATTGGTGAGCGAGGAGCCGGTGACCAACGGCCTCAAGGATGGCATCGTTTTCCTCTTAAAACGCCAGGACTTCAGCCTGGTGGTCAGCACCAAGAAGGTCCCATTCTTCAAACTCTCCGAGGAATTTGTGGATCCCAAGTCACACAAGTTTGTCATGAGGCTGCAGTC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhaoming Wu et al.
Cell and tissue research, 366(3), 617-621 (2016-09-04)
Vangl2, one of the core components of the planar cell polarity (PCP) pathway, has an important role in the regulation of morphogenesis in several tissues. Although the expression of Vangl2 has been detected in the developing tooth, its role in
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica