Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU009371

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPJ

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTCGAAGATCCAAGTCTGCACCTCCTCGTGATTTAGGCAATTTGGATAAGGGACAAGCTGCCTCTCCCAGGGAGCCACTTGAACCACTGAACTTCCCAGATCCTGAATATAAAGAGGAGGAGGAAGACCAAGACATACAGGGAGAAATCAGTCATCCTGATGGAAAGGTGGAAAAGGTTTATAAGAATGGGTGCCGTGTTATACTGTTTCCCAATGGAACTCGAAAGGAAGTGAGTGCAGATGGGAAGACCATCACTGTCACTTTCTTTAATGGTGACGTGAAGCAGGTCATGCCAGACCAAAGAGTGATCTACTACTATGCAGCTGCCCAGACCACTCACACGACATACCCGGAGGGACTGGAAGTCTTACATTTCTCAAGTGGACAAATAGAAAAACATTACCCAGATGGAAGAAAAGAAATCACGTTTCCTGACCAGACTGTTAAAAACTTATTTCCTGATGGACAAGAAGAAAGCATTTTCCCAGATGGTACAATTGTCAGAGTACAACGTGATGGCAACAAACT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tao Xu et al.
Toxicology letters, 294, 177-183 (2018-05-21)
Alcohol can decrease cell proliferation in neural cells. The proliferation of neural cells can be inhibited by the asymmetric division of neural progenitor cells. However, whether alcohol inhibits cell proliferation through inducing cell asymmetric division is not yet clear. Here
Patricia P Garcez et al.
Nature communications, 6, 6474-6474 (2015-03-11)
The proneural factor Ascl1 controls multiple steps of neurogenesis in the embryonic brain, including progenitor division and neuronal migration. Here we show that Cenpj, also known as CPAP, a microcephaly gene, is a transcriptional target of Ascl1 in the embryonic

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica