Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

Outros documentos

EHU009241

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB6 (2)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCCATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTTATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAGCTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGAACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGCCATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACAGCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAGCCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

Ensembl | Número de adesão de ser humano

ENSG00000115221

nº de adesão NCBI

NM_000888

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ITGB6(3694) , ITGB6(3694)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Robert J Slack et al.
Pharmacology, 97(3-4), 114-125 (2016-01-07)
A20FMDV2 is a peptide derived from the foot-and-mouth disease virus with a high affinity and selectivity for the alpha-v beta-6 (αvβ6) arginyl-glycinyl-aspartic acid (RGD)-binding integrin. It has been shown to be an informative tool ligand in pre-clinical imaging studies for
Jiarui Bi et al.
Cytokine, 114, 135-142 (2018-11-24)
Epithelial αvβ6 integrin participates in immune surveillance in many organs, including the gastrointestinal track. Expression of αvβ6 integrin is reduced in the junctional epithelium of the gingiva in periodontal diseases, and mutations in the ITGB6 gene are associated with these
Runhong Han et al.
JCI insight, 4(7) (2019-04-05)
Chronic tubulointerstitial injury impacts the prognosis of focal segmental glomerulosclerosis (FSGS). We found that the level of versican V1 was increased in tubular cells of FSGS patients. Tubular cell-derived versican V1 induced proliferation and collagen synthesis by activating the CD44/Smad3
Jiarui Bi et al.
Scientific reports, 7(1), 4411-4411 (2017-07-02)
Periodontal diseases manifest by the formation of deep pockets between the gingiva and teeth where multispecies bacterial biofilms flourish, causing inflammation and bone loss. Epithelial cell receptor αvβ6 integrin that regulates inflammation by activating the anti-inflammatory cytokine transforming growth factor-β1

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica