Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU007971

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTCTCCCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGAAGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAGCCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTCCAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Anand Kumar Gupta et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 5087-5101 (2017-08-03)
In visceral leishmaniasis, we found that the antileishmanial drug Amp B produces a higher level of IL-1β over the infected control. Moreover, administering anti-IL-1β antibody to infected Amp B-treated mice showed significantly less parasite clearance. Investigation revealed that
Corina T Madreiter-Sokolowski et al.
Oncotarget, 8(46), 80278-80285 (2017-11-09)
Cancer cells have developed unique strategies to meet their high energy demand. Therefore, they have established a setting of Ca
Jin Hee Lee et al.
Oncology letters, 20(6), 374-374 (2020-11-07)
The uncoupling protein-2 (UCP2) serves a role in tumor aggressiveness and anticancer resistance, which is considered to be associated with its ability to attenuate reactive oxygen species (ROS) production. We hypothesized that UCP2 may protect cancer cells from elesclomol-induced cytotoxicity
Rebecca F Hough et al.
JCI insight, 4(3) (2019-02-08)
Acid aspiration, which can result from several etiologies, including postoperative complications, leads to direct contact of concentrated hydrochloric acid (HCl) with the alveolar epithelium. As a result, rapid endothelial activation induces alveolar inflammation, leading to life-threatening pulmonary edema. Because mechanisms
Rui Zhang et al.
BioMed research international, 2020, 6537371-6537371 (2020-09-17)
As a common disorder, acute kidney injury (AKI) is characterized by high mortality and morbidity, and current therapeutic options for AKI remain limited. Irisin, a muscle factor, plays an important role in metabolic disorders. However, the role of irisin in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica