Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU007521

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH8

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAAGTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAGCAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACTTCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGATCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAGCTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGAAAATGGGAGAAGTTGCAGATGACGTCCA

Ensembl | Número de adesão de ser humano

ENSG00000165406

nº de adesão NCBI

NM_001002265
NM_001002266
NM_145021

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MARCH8(220972) , MARCH8(220972)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shanglin Guo et al.
Anatomical record (Hoboken, N.J. : 2007), 302(12), 2271-2278 (2019-08-24)
Tumor necrosis factor-α (TNF-α) is an important inflammatory cytokine that plays a key role in neuronal damage. Elevated expression of TNF-α is associated with numerous neurodegenerative diseases including Alzheimer's Disease and Parkinson's Disease. However, the specific mechanism of the signaling
Shivam Singh et al.
Cancer cell international, 17, 116-116 (2017-12-08)
Herein, for the first time, we report aberrant expression of membrane-associated RING-CH8 (MARCH8) in human esophageal squamous cell carcinoma. MARCH8 is a member of the recently discovered MARCH family of really interesting new genes (RING) E3 ligases. Though initial studies
Sriganesh B Sharma et al.
Molecular and cellular biology, 34(22), 4143-4164 (2014-09-10)
Despite the low prevalence of activating point mutation of RAS or RAF genes, the RAS-extracellular signal-regulated kinase (ERK) pathway is implicated in breast cancer pathogenesis. Indeed, in triple-negative breast cancer (TNBC), there is recurrent genetic alteration of pathway components. Using

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica