Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

Outros documentos

EHU007001

Sigma-Aldrich

MISSION® esiRNA

targeting human DSP

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGAAGTCGTTGTTGGCCACTATGAAGACAGAACTACAGAAAGCCCAGCAGATCCACTCTCAGACTTCACAGCAGTATCCACTTTATGATCTGGACTTGGGCAAGTTCGGTGAAAAAGTCACACAGCTGACAGACCGCTGGCAAAGGATAGATAAACAGATCGACTTTAGGTTATGGGACCTGGAGAAACAAATCAAGCAATTGAGGAATTATCGTGATAACTATCAGGCTTTCTGCAAGTGGCTCTATGATGCTAAACGCCGCCAGGATTCCTTAGAATCCATGAAATTTGGAGATTCCAACACAGTCATGCGGTTTTTGAATGAGCAGAAGAACTTGCACAGTGAAATATCTGGCAAACGAGACAAATCAGAGGAAGTACAAAAAATTGCTGAACTTTGCGCCAATTCAATTAAGGATTATGAGCTCCAGCTGGC

Ensembl | Número de adesão de ser humano

ENSG00000096696

nº de adesão NCBI

NM_004415

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DSP(1832) , DSP(1832)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Haiyong Wang et al.
Aging, 11(17), 6657-6673 (2019-09-05)
Long non-coding RNAs (lncRNAs) have been implicated in the pathogenesis of gastric cancer; however, their mechanisms of action remain largely unknown. The aim of this study was to identify lncRNAs involved in the tumorigenesis of gastric cancer and to investigate
Peipei Li et al.
International journal of biological sciences, 15(11), 2350-2362 (2019-10-09)
The interaction between genomic DNA and protein fundamentally determines the activity and the function of DNA elements. Capturing the protein complex and identifying the proteins associated with a specific DNA locus is difficult. Herein, we employed CRISPR, the well-known gene-targeting
Aritro Nath et al.
Molecular cancer research : MCR, 19(2), 240-248 (2020-10-28)
Elevated uptake of saturated fatty acid palmitate is associated with metastatic progression of cancer cells; however, the precise signaling mechanism behind the phenomenon is unclear. The loss of cell adhesion proteins, such as desmoplakin (DSP), is a key driving event
Dipal M Patel et al.
The Journal of cell biology, 206(6), 779-797 (2014-09-17)
Mechanisms by which microtubule plus ends interact with regions of cell-cell contact during tissue development and morphogenesis are not fully understood. We characterize a previously unreported interaction between the microtubule binding protein end-binding 1 (EB1) and the desmosomal protein desmoplakin
Johan Sternemalm et al.
PloS one, 10(8), e0134789-e0134789 (2015-08-05)
Deleterious mutations of the Centrosome/Spindle Pole associated Protein 1 gene, CSPP1, are causative for Joubert-syndrome and Joubert-related developmental disorders. These disorders are defined by a characteristic mal-development of the brain, but frequently involve renal and hepatic cyst formation. CSPP-L, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica