Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU006891

Sigma-Aldrich

MISSION® esiRNA

targeting human TIGAR

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCCTGAAAGAAGCGGATCAAAAAGAACAGTTTTCCCAAGGATCTCCAAGCAACTGTCTGGAAACTTCTTTGGCAGAGATATTTCCTTTAGGAAAAAATCACAGCTCTAAAGTTAATTCAGACAGCGGTATTCCAGGATTAGCAGCCAGTGTCTTAGTTGTGAGTCACGGTGCTTACATGAGAAGTCTGTTTGATTATTTTCTGACTGACCTTAAGTGTTCCTTACCAGCCACTCTGAGCAGATCTGAACTTATGTCAGTCACTCCCAATACAGGGATGAGTCTCTTTATCATAAACTTTGAGGAAGGAAGAGAAGTTAAACCAACGGTTCAGTGTATTTGTATGAACCTACAGGATCATCTAAATGGACTGACTGAAACTCGCTAAGGTTAAATCTGCATCAAAATCTAACCATTTTGAGCCTCTGAAGGGAGTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
Wen-feng Gou et al.
BMC cancer, 14, 477-477 (2014-07-06)
RhoC is a small G protein/GTPase and involved in tumor mobility, invasion and metastasis. Previously, up-regulated RhoC expression is found to play an important role in ovarian carcinogenesis and subsequent progression by modulating proliferation, apoptosis, migration and invasion. We transfected
Dao Chao Huang et al.
Endocrinology, 155(10), 3739-3749 (2014-07-23)
The role of PTHrP in the highly metastatic human melanoma disease is not known. This study investigates the mechanisms of action of this secreted factor through homozygous inactivation of the Pthrp gene in A375 human melanoma cells. In vitro, Pthrp-ablated

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica