Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

Outros documentos

EHU005381

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGGACGTCAGAGCTTCTCCGTGAAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGATGCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACTGCCATT

Ensembl | Número de adesão de ser humano

ENSG00000198625

nº de adesão NCBI

NM_002393

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MDM4(4194) , MDM4(4194)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kehua Jiang et al.
Molecular genetics & genomic medicine, 7(8), e833-e833 (2019-06-30)
MicroRNA-33a (miR-33a) plays the role of the tumor suppressor gene by regulating the expression level of downstream genes. However, the effects of miR-33a in renal cell cancer (RCC) remain unknown. Our study was designed to investigate the expression level and
Haishan Zhang et al.
Molecular immunology, 125, 9-14 (2020-07-04)
MiR-483-3p is involved in the pathogenesis of acute myocardial infarctions, but its association with myocardial ischemia reperfusion (IR) remains mostly unknown. In this study, an in vitro model of myocardial IR injury was established by putting H9c2 cells into hypoxia
Hong Yan et al.
American journal of cancer research, 9(2), 312-329 (2019-03-25)
Activated KRAS is frequently observed and paralleled by inactivating of tumor suppressors in lung cancer, while the mechanisms remained elusive. Here, our study revealed a microRNA was involved in KRAS overexpression, activation of KRAS signaling and its synergy with inactivating
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica