Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU004551

Sigma-Aldrich

MISSION® esiRNA

targeting human STS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTCATGGCGGAAGTAATGGGATCTATAAAGGAGGAAAAGCAAACAACTGGGAAGGAGGTATCCGGGTTCCAGGCATCCTTCGTTGGCCCAGGGTGATACAGGCTGGCCAGAAGATTGATGAGCCCACTAGCAACATGGACATATTTCCTACAGTAGCCAAGCTGGCTGGAGCTCCCTTGCCTGAGGACAGGATCATTGATGGACGTGATCTGATGCCCCTGCTTGAAGGAAAAAGCCAACGCTCCGATCATGAGTTTCTCTTCCATTACTGCAACGCCTACTTAAATGCTGTGCGCTGGCACCCTCAGAACAGCACATCCATCTGGAAGGCCTTTTTCTTCACCCCCAACTTCAACCCCGTGGGTTCCAACGGATGCTTTGCCACACACGTGTGCTTCTGTTTCGGGAGTTATGTCACCCATCACGACCCACCTTTAC

Ensembl | Número de adesão de ser humano

ENSG00000101846

nº de adesão NCBI

NM_000351

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... STS(412) , STS(412)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hee-Jung Im et al.
Biomolecules & therapeutics, 20(6), 556-561 (2013-09-07)
Steroid sulfatase (STS) is responsiblefor the conversion of estrone sulfate to estrone that can stimulate growth in endocrine-dependent tumors such as prostate cancer. Although STS is considered as a therapeutic target for the estrogen-dependent diseases, cellular function of STS are
Cameron M Armstrong et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6064-6074 (2020-09-16)
Most patients with prostate cancer receiving enzalutamide or abiraterone develop resistance. Clinical evidence indicates that serum levels of dehydroepiandrosterone sulfate (DHEAS) and biologically active DHEA remain in the high range despite antiandrogen treatment. The conversion of DHEAS into DHEA by
Amy M Gratton et al.
Placenta, 48, 72-79 (2016-11-23)
Preeclampsia is a serious complication of pregnancy affecting 5% of pregnancies. Our team identified 137 genes highly expressed in placenta relative to other human tissues. Here, we have explored a role for steroid sulfatase (STS) in preeclampsia by characterising STS
Mengxi Jiang et al.
Journal of hepatology, 64(1), 44-52 (2015-07-30)
Chronic inflammatory liver diseases are associated with estrogen excess and feminization in men, which is thought to be due to compromised liver function to break down estrogens. The goal of this study is to determine whether the inflammatory induction of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica