Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU003621

Sigma-Aldrich

MISSION® esiRNA

targeting human WEE1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATACAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nupam P Mahajan et al.
Oncotarget, 8(63), 106352-106368 (2018-01-02)
Epigenetic signaling networks dynamically regulate gene expression to maintain cellular homeostasis. Previously, we uncovered that WEE1 phosphorylates histone H2B at tyrosine 37 (pY37-H2B) to negatively regulate global histone transcriptional output. Although pY37-H2B is readily detected in cancer cells, its functional
Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Global Trade Item Number

SKUGTIN
EHU003621-50UG4061828443963
EHU003621-20UG4061831360394

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica