Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

Ensembl | Número de adesão de ser humano

ENSG00000140941

nº de adesão NCBI

NM_022818

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MAP1LC3B(81631) , MAP1LC3B(81631)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Alok Ranjan et al.
Scientific reports, 6, 26165-26165 (2016-05-18)
Pancreatic tumors exhibit enhanced autophagy as compared to any other cancer, making it resistant to chemotherapy. We evaluated the effect of penfluridol against pancreatic cancer. Penfluridol treatment induced apoptosis and inhibited the growth of Panc-1, BxPC-3 and AsPC-1, pancreatic cancer
Sheeja Aravindan et al.
Journal of biomedical science, 22, 28-28 (2015-04-22)
Identifying the drug-deliverables that target autophagy is crucial to finding a cure for pancreatic cancer (PC), as activated autophagy is associated with poor patient outcomes. Our recent studies recognized the anti-PC potential of an antioxidant-rich collection of seaweed polyphenols and
S Kumar et al.
Cell death & disease, 4, e889-e889 (2013-11-02)
Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica