Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU002001

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA

Ensembl | Número de adesão de ser humano

ENSG00000196591

nº de adesão NCBI

NM_001527

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC2(3066) , HDAC2(3066)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jie Gao et al.
Gene, 678, 1-7 (2018-08-01)
Chronic diabetic foot ulcer (DFU) is a major cause of disability and mortality in patients with diabetes. Dysfunctional endothelial progenitor cells (EPCs) play important roles in preventing vascular complications in these patients. Our results determined the elevated expression of histone
Wen-Feng Fang et al.
Journal of inflammation (London, England), 15, 3-3 (2018-01-19)
Sepsis is a life-threatening organ dysfunction caused by dysregulated host response to infection, and is primarily characterized by an uncontrolled systemic inflammatory response. In the present study, we developed an effective adjunct therapy mediated by a novel mechanism, to attenuate
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific
Shenglei Li et al.
Oncology letters, 13(1), 403-409 (2017-01-27)
Increasing evidence has demonstrated that histone deacetylase 2 (HDAC2) participates in the regulation of a variety of biological processes in numerous tumors. However, the potential role of HDAC2 in the development and progression of esophageal squamous cell carcinoma (ESCC) remains
Wei Dai et al.
World journal of gastroenterology, 25(38), 5789-5799 (2019-10-23)
Hepatocellular carcinoma (HCC) has become a great threat for people's health. Many long noncoding RNAs are involved in the pathogenesis of HCC. SNHG15, as a tissue specific long noncoding RNAs, has been studied in many human cancers, except HCC. To
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica