Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

View All Documentation

EHU001661

Sigma-Aldrich

MISSION® esiRNA

targeting human CNOT2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTGGAAGAGCTCCTTATGTTGGAATGGTAACAAAACCAGCAAATGAACAATCCCAGGACTTCTCAATACACAATGAAGATTTTCCAGCATTACCAGGCTCCAGCTATAAAGATCCAACATCAAGTAATGATGACAGTAAATCTAATTTGAATACATCTGGCAAGACAACTTCAAGTACAGATGGACCCAAATTCCCTGGAGATAAAAGTTCAACAACACAAAATAATAACCAGCAGAAAAAAGGGATCCAGGTGTTACCTGATGGTCGGGTTACTAACATTCCTCAAGGGATGGTGACGGACCAATTTGGAATGATTGGCCTGTTAACATTTATCAGGGCAGCAGAGACAGACCCAGGAATGGTACATCTTGCATTAGGAAGTGACTTAACAACATTAGGCCTCAATCTGAACTCTCCTGAAAATCTCTACCCCAAATTTGCGTCACCCTGGGCATCTTCACCTTGTCGACCTCAAGACATAGACTTCCATGTTCCATCTGAGTACTTAACGAACATTCACATTAGGGATAAGCTGGCTGCAATAAAACTTGGCCGATATGGTGAAG

Ensembl | Número de adesão de ser humano

ENSG00000111596

nº de adesão NCBI

NM_014515

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CNOT2(4848) , CNOT2(4848)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Eun Jung Sohn et al.
Cancer letters, 412, 88-98 (2017-10-13)
Here the underlying role of CNOT2, a subunit of CCR4-NOT complex, was elucidated in cancer progression. CNOT2 was overexpressed in HIT-T15, ASPC-1, BXPC-3, PC-3, LNCaP, MCF-7 and MDA-MB-231 cell lines, which was confirmed by Tissue array in various human tumor
Eun-Ok Kim et al.
International journal of molecular medicine, 45(2), 324-332 (2020-01-03)
TRAIL is an attractive candidate for anticancer therapy in a variety of tumors since it targets only tumors and not normal tissue. However, a remaining major hurdle is that the majority of tumors exhibit a resistance mechanism against the effects
Kwon Jeong et al.
Oncotarget, 8(28), 46034-46046 (2017-05-26)
Though CNOT2 is involved in regulation of adipogenic differentiation, apoptotic cell death and metastasis, the underlying autophagic mechanism of CNOT2 was unknown until now. Thus, in the present study, the critical role of CNOT2 in autophagy was elucidated in association

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica