Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Ensembl | Número de adesão de ser humano

ENSG00000178999

nº de adesão NCBI

NM_004217

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AURKB(9212) , AURKB(9212)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Aarthi Jayanthan et al.
Journal of pediatric hematology/oncology, 41(6), e359-e370 (2019-02-01)
Recent studies have shown that cell cycle events are tightly controlled by complex and shared activities of a select group of kinases. Among these, polo-like kinases (Plks) are regulatory mitotic proteins that are overexpressed in several types of cancer and
Zhibin Yu et al.
Journal of hematology & oncology, 10(1), 115-115 (2017-06-10)
SIX homeobox 3 (SIX3) is a member of the sine oculis homeobox transcription factor family. It plays a vital role in the nervous system development. Our previous study showed that the SIX3 gene is hypermethylated, and its expression is decreased
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica