Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU001251

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCACTGGTTCCCAGAAAAGCCATGCAAGGGATCGGGTTACCGTTGTATTCGCATCAACCATAAAATGGATCCTCTGATTGGACAGGCAGCACAGCGGATTGGACTGAGCAGTCAGGAGCTGTTCAGGCTTCTCCCAAGTGAACTCACACTCTGGGTTGACCCCTATGAAGTGTCCTACAGAATTGGAGAGGATGGCTCCATCTGTGTGCTGTATGAAGCCTCACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATGGTAGACAGCCGAATCAGCTGTAAGGAGGAACTTCTCTTGGGCAGAACGAGCCCTTCCAAAAACTACAATATGATGACTGTATCAGGTTAAGATATAGTCTGTGGATGGATCATCTGATGATGATGGATAAATTTGATTTTTGCTTTGGGTGGGCTCCTCTTGGGGATGGATTATGGA

Ensembl | Número de adesão de ser humano

ENSG00000133639

nº de adesão NCBI

NM_001731

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... BTG1(694) , BTG1(694)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jeong Sook Kim et al.
International journal of molecular sciences, 20(13) (2019-07-22)
Estrogen affects endometrial cellular proliferation by regulating the expression of the c-myc gene. B-cell translocation gene 1 (BTG1), a translocation partner of the c-myc, is a tumor suppressor gene that promotes apoptosis and negatively regulates cellular proliferation and cell-to-cell adhesion.
Peng Yin et al.
Cancer chemotherapy and pharmacology, 81(5), 863-872 (2018-03-15)
Nasopharyngeal carcinoma (NPC) is one of the most commonly diagnosed cancers worldwide with significantly high prevalence in Southern China. Chemoprevention of cancer with alkylating agent compounds could potentially reverse, suppress, or prevent cancer progression. Cisplatin (CIS) is an antineoplastic or
Zhen-Zhen Zhang et al.
American journal of physiology. Endocrinology and metabolism, 316(6), E1050-E1060 (2019-03-06)
Diabetic retinopathy (DR) is a serious diabetic complication caused by both environmental and genetic factors. Molecular mechanisms of DR may lead to the discovery of reliable prognostic indicators. The current study aimed to clarify the mechanism of microRNA-183 (miR-183) in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica