Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

Visualizar Toda a Documentação

EHU000571

Sigma-Aldrich

MISSION® esiRNA

targeting human SOAT1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAACGTGCCTCGGGTACTAAATTCAGCTAAGGAGAAATCAAGCACTGTTCCAATACCTACAGTCAACCAGTATTTGTACTTCTTATTTGCTCCTACCCTTATCTACCGTGACAGCTATCCCAGGAATCCCACTGTAAGATGGGGTTATGTCGCTATGAAGTTTGCACAGGTCTTTGGTTGCTTTTTCTATGTGTACTACATCTTTGAAAGGCTTTGTGCCCCCTTGTTTCGGAATATCAAACAGGAGCCCTTCAGCGCTCGTGTTCTGGTCCTATGTGTATTTAACTCCATCTTGCCAGGTGTGCTGATTCTCTTCCTTACTTTTTTTGCCTTTTTGCACTGCTGGCTCAATGCCTTTGCTGAGATGTTACGCTTTGGTGACAGGATGTTCTATAAGGATTGGTGGAACTCCACGTCATACTCCAACTATTATAGAACCTGGAATGTGGTGGTCCATGACTGGCTATATTACTATGCTTACAAGGACTTTCTCTGGTTTTTCTCCAAGAGATTCAAATCTGCTGCCATGTTAGCTGTCTTTGCTGTATCTGCTGTAGTACACGAATATGCCTTGGCTGTTT

Ensembl | Número de adesão de ser humano

ENSG00000057252

nº de adesão NCBI

NM_003101

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SOAT1(6646) , SOAT1(6646)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
CEV
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhaoe Liu et al.
DNA and cell biology, 35(11), 730-739 (2016-11-01)
Pycnogenol
Yu Xu et al.
Theranostics, 10(24), 11302-11323 (2020-10-13)
Background: Activation of the thermogenic program in white and brown adipocytes presents a promising avenue for increasing energy expenditure during the treatment of obesity. The endogenous mechanism for promoting thermogenesis in brown adipocytes or browning in white adipocytes has indicated
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls
Wataru Amano et al.
The Journal of allergy and clinical immunology, 136(3), 667-677 (2015-06-28)
Barrier disruption and the resulting continuous exposure to allergens are presumed to be responsible for the development of atopic dermatitis (AD). However, the mechanism through which skin barrier function is disrupted in patients with AD remains unclear. Taking into account
Feng Geng et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(21), 5337-5348 (2016-11-03)
Elevated lipogenesis regulated by sterol regulatory element-binding protein-1 (SREBP-1), a transcription factor playing a central role in lipid metabolism, is a novel characteristic of glioblastoma (GBM). The aim of this study was to identify effective approaches to suppress GBM growth

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica