Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU000271

Sigma-Aldrich

MISSION® esiRNA

targeting human F2R

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGGCTCAACATCACTACCTGTCATGATGTGCTCAATGAAACCCTGCTCGAAGGCTACTATGCCTACTACTTCTCAGCCTTCTCTGCTGTCTTCTTTTTTGTGCCGCTGATCATTTCCACGGTCTGTTATGTGTCTATCATTCGATGTCTTAGCTCTTCCGCAGTTGCCAACCGCAGCAAGAAGTCCCGGGCTTTGTTCCTGTCAGCTGCTGTTTTCTGCATCTTCATCATTTGCTTCGGACCCACAAACGTCCTCCTGATTGCGCATTACTCATTCCTTTCTCACACTTCCACCACAGAGGCTGCCTACTTTGCCTACCTCCTCTGTGTCTGTGTCAGCAGCATAAGCTGCTGCATCGACCCCCTAATTTACTATTACGCTTCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Zhuang-Zhuang Tang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 78, 153314-153314 (2020-09-04)
Sarsasapogenin (Sar) shows good effects on diabetic nephropathy (DN) through inhibition of the NLRP3 inflammasome, yet the potential mechanism is not well known. This study was designed to explore the regulation of thrombin and/or its receptor protease-activated receptor 1 (PAR-1)
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica