Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU208701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dlc1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAAAGAAAACAGAGTTTGGGCAAACCAGACCAGAAAGACCTGAATGAAAACCTAGCGGCGACTCAAGGGCTGGCCCACATGATTGCTGAGTGCAAGAAGCTCTTCCAGGTCCCTGAGGAAATGAGCCGGTGCCGTAACTCCTACACTGAACAAGAGCTGAAGCCCCTTACCCTGGAGGCCTTGGGACACCTGAATAGTGACCAGCCTGCTGACTACAGACACTTCCTCCAGGACTGTGTGGATGGCCTGTTTAAGGAGGTCAAAGAGAAGTTCAAAGGCTGGGTCAGCTACCCCACCTCCGAACAGGCTGAGCTGTCCTATAAGAAGGTCAGCGAAGGACCCCCGTTAAGGCTTTGGAGGTCAACTATCGAAGTCCCCGCTGCACCCGAGGAGATCTTAAAGCGCCTTCTGAAGGAGCAACACCTCTGGGATGTGGACCTGCTGGACTCCAAGGTGATTGAAATCCTGGACAGCCAGACTGAAATCTACCAATACGTCCAAAACAGCA

Numéro d'accès Ensembl | souris

ENSMUSG00000031523

Numéro d'accès NCBI

NM_015802

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... DLC1(50768) , Dlc1(50768)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mohammad Golam Sabbir et al.
PloS one, 7(7), e40302-e40302 (2012-07-14)
The Deleted in liver cancer one (Dlc1) tumor suppressor gene encodes a RhoGTPase activating protein (RhoGAP). The Dlc1 gene has multiple transcriptional isoforms and we have previously established a mouse strain containing a gene trap (gt) insertion, which specifically reduces
Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Yi-Ping Shih et al.
Biochimica et biophysica acta, 1853(12), 3258-3265 (2015-10-03)
DLC1 is a RhoGAP-containing tumor suppressor and many of DLC1's functions are absolutely dependent on its RhoGAP activity. Through its RhoGAP domain, DLC1 inhibits the activity of RhoA GTPase, which regulates actin cytoskeleton networks and dis/assembly of focal adhesions. Tensin1
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique