Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU170821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAATGCTGAGCCTTTGCTGAGATAACTTGGACCTGAGTGACATGCCACATCTAAGCCACGCATCCCAGCTTTTCCAGCCAGGGCCTCCTAGCAGGATCTTAGAGAAGGAGACAGTGGTATTTTGAAACTGGATATCAAATATTTTTGGTTTTGCTTTAAAGTGGCTACCTCTCTTTGGTTTTGTGGCTTTGCTCTATTGTGACGTGGACTTAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCATACAGGGCTGCTAATGCAGCCCATGGGTAAGTGTGGTTATATGTGTTTGTGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGG

Numéro d'accès Ensembl | souris

ENSMUSG00000017716

Numéro d'accès NCBI

NM_009689

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... BIRC5(11799) , Birc5(11799)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eloïse Véquaud et al.
Breast cancer research and treatment, 155(1), 53-63 (2015-12-19)
Survivin overexpression, frequently found in breast cancers and others, is associated with poor prognosis. Its dual regulation of cell division and apoptosis makes it an attractive therapeutic target but its exact functions that are required for tumor maintenance are still
Sanam Arami et al.
Current pharmaceutical design, 23(16), 2400-2409 (2016-11-02)
Targeted delivery of small interfering RNA (siRNA) to the specific tumor tissues and cells is the key challenge in the development of RNA interference as a therapeutic application. To target breast cancer, we developed a cationic nanoparticle as a therapeutic
Yongping Cai et al.
International journal of clinical and experimental pathology, 8(10), 13267-13272 (2016-01-02)
Survivin, a member of the inhibitor of apoptosis gene family regulates two critical processes in neoplastic transformation, namely, cell proliferation and apoptosis. This study aimed to detect the effect of survivin on tumor growth of colorectal cancer (CRC) in vivo.
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Yuhuan Li et al.
Pakistan journal of pharmaceutical sciences, 28(5 Suppl), 1887-1890 (2015-11-04)
Breast cancer resistance to therapy can result from expression of antiapoptotic genes. Survivin is an antiapoptotic gene that is over expressed in most human tumors. RNA interference using short interfering RNA (siRNA) can be used to specifically inhibit survivin expression.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique