Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU076911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppp3ca

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACACGGTGGTTTGTCTCCAGAGATTAACACTCTAGATGACATCAGAAAATTAGACCGATTCAAAGAACCACCTGCTTATGGGCCCATGTGTGACATCCTATGGTCAGACCCCCTGGAGGACTTTGGAAATGAGAAGACTCAGGAACATTTCACTCACAACACAGTCAGAGGCTGTTCGTACTTCTACAGTTACCCAGCTGTGTGTGACTTCCTGCAGCACAATAATTTGTTGTCCATACTCCGCGCCCACGAAGCCCAGGATGCAGGGTACCGCATGTACAGGAAAAGCCAAACAACAGGCTTCCCGTCTCTAATTACAATCTTCTCGGCACCAAATTACTTAGATGTGTACAATAACAAAGCTGCAGTGTTGAAGTACGAGAACAATGTGATGAACATCAGGCAGTTCAACTGCTCCCCGCATCCGTACTGGCTCCCAAATTTCATG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique