Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU074201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vdac1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGACGGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGAAGTTGGAGACTGCTGTCAATCTCGCCTGGACTGCAGGAAACAGTAACACTCGCTTCGGAATAGCAGCCAAGTATCAGGTCGACCCTGATGCCTGCTTTTCGGCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGCCCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTGTACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGGATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Meghraj Singh Baghel et al.
Molecular neurobiology, 56(3), 1707-1718 (2018-06-20)
Our previous report on hippocampal proteome analysis suggested the involvement of voltage-dependent anion channel (Vdac) 1 in scopolamine-induced amnesia. Further silencing of Vdac1 in young mice reduced the recognition memory. Vdac1 is a porin protein present abundantly on outer mitochondrial
A Mitra et al.
Cell death & disease, 4, e582-e582 (2013-04-06)
Cardiac hypertrophy and myocardial infarction (MI) are two major causes of heart failure with different etiologies. However, the molecular mechanisms associated with these two diseases are not yet fully understood. So, this study was designed to decipher the process of
Sergio Gonzalez et al.
The Journal of clinical investigation, 126(3), 1023-1038 (2016-02-16)
Schwann cells produce myelin sheath around peripheral nerve axons. Myelination is critical for rapid propagation of action potentials, as illustrated by the large number of acquired and hereditary peripheral neuropathies, such as diabetic neuropathy or Charcot-Marie-Tooth diseases, that are commonly

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique