Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU067171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xrcc6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCAAGCAAGCTGGAAGACCTGCTAAGGAAGGTTCGAGCCAAGGAGACCAAAAAGCGAGTTCTGTCCAGGTTAAAGTTTAAGCTCGGTGAAGACGTAGTACTCATGGTGGGCATTTATAACTTGGTCCAGAAAGCTAACAAGCCTTTTCCAGTGAGACTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACACCGGCAGTCTACTCCTGCCTAGTGACACCAAGCGGTCTCTGACTTACGGGACACGTCAGATTGTGCTGGAGAAAGAGGAGACAGAGGAGCTGAAGCGGTTTGATGAGCCAGGTTTGATCCTCATGGGCTTTAAGCCCACGGTGATGCTGAAGAAGCAGCACTACCTGAGGCCCTCTCTGTTCGTGTACCCAGAGGAGTCCCTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Bahityar Rahmutulla et al.
Oncotarget, 5(9), 2404-2417 (2014-05-09)
The far-upstream element-binding protein-interacting repressor (FIR) is a c-myc transcriptional suppressor. FIR is alternatively spliced to lack the transcriptional repression domain within exon 2 (FIRΔexon2) in colorectal cancers. FIR and FIRΔexon2 form homo- or heterodimers that complex with SAP155. SAP155
Jin Meng et al.
Molecular medicine reports, 12(1), 581-586 (2015-02-20)
It was previously reported that the histone deacetylase inhibitor (HDACI) trichostatin A (TSA) induced B cell lymphoma 2 (Bcl-2)-associated X protein (Bax)-dependent apoptosis in colorectal cancer (CRC) cells. In addition, Ku70 has been identified as a regulator of apoptosis, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique