Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU061611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdpn

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGCTTGCCAGTAGTCACCCTGGTTGGAATCATAGTTGGCGTCTTGTTAGCCATTGGCTTCGTCGGAGGGATCTTCATTGTTGTTATGAAGAAGATTTCTGGAAGGTCTCGCCCTAAAGAGCTAAACAGAACAGGTTGTTCTCCCAACACATCTGAAAATAAGAGAGCTTCCAACTTGCCCTGTTCCCCATCCTCTTCCTGTGGAGGAAGATGACCCATGGCGTGCCCACCCACCCCACCCACAGCCATGGTGACCCCTCCGCTTGGCCAGCAGTACCAAAGGAAAGATACAGGACAAGCCACAGCCCCTCAAAGCATCTGCCTTTGGAAAACTAAATTTTTAACATAAATGTTATGATCGATGATTCAAAAGACAACATGCTTAGAAAATGGAGCAAAGCCAA

Numéro d'accès Ensembl | souris

ENSMUSG00000028583

Numéro d'accès NCBI

NM_010329

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... PDPN(14726) , Pdpn(14726)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Frédéric Larrieu-Lahargue et al.
PloS one, 7(6), e39540-e39540 (2012-07-05)
Fibroblast Growth Factor receptor (FGFR) activity plays crucial roles in tumor growth and patient survival. However, FGF (Fibroblast Growth Factor) signaling as a target for cancer therapy has been under-investigated compared to other receptor tyrosine kinases. Here, we studied the
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yoshihiko Sawa et al.
PloS one, 9(5), e97165-e97165 (2014-05-20)
The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS)
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique