Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU057051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCTAAGGACCCTGCAAATTATATTCTCCATGCAGTCTTGGTTCACAGTGGAGATAATCATGGTGGACATTACGTGGTTTACCTAAACCCCAAAGGGGATGGCAAATGGTGTAAGTTCGATGATGACGTGGTATCCAGGTGTACTAAAGAAGAAGCCATTGAGCACAATTATGGGGGTCATGATGATGATCTGTCTGTTCGACACTGCACAAATGCCTATATGTTAGTGTACATCAGGGAATCAAAGCTAAGTGAAGTGTTACAAGCTGTCACCGACCATGATATTCCTCAGCAGTTGGTGGAACGATTGCAAGAAGAGAAAAGGATCGAGGCTCAGAAGCGGAAGGAGCGGCAGGAAGCCCATCTCTACATGCAAGTGCAGATAGTTGCAGAGGACCAGTTTTGTGGCCACCAAGGAAATGACATGTACGACGAGGAGAAAGTGAGGTACACTGTGTTCAAGGTTCTGAAGAACTCCTCCCTGGCCGAGTTTGTTCAGAGCCTCTCCCAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Serena Giovinazzi et al.
Oncotarget, 5(11), 3728-3742 (2014-07-09)
USP7 (Ubiquitin Specific processing Protease-7) is a deubiquitinase which, over the past decade emerged as a critical regulator of cellular processes. Deregulation of USP7 activity has been linked to cancer, making USP7 inhibition an appealing anti-cancer strategy. The identification of
Key-Hwan Lim et al.
Scientific reports, 5, 12793-12793 (2015-08-05)
HAUSP (herpes virus-associated ubiquitin specific protease, known as ubiquitin specific protease 7), one of DUBs, regulates the dynamics of the p53 and Mdm2 network in response to DNA damage by deubiquitinating both p53 and its E3 ubiquitin ligase, Mdm2. Its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique