Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU055721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akt3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGACGGGAATAAGTTCCTTTCAGTCTGTTTCTACACTGTCATCTTAGACTTTGCCTGAGACTGATTCCTGGACATCTCTACCAGTCCTCGCTCTTACAGTTAGCAGGGGCACCTTCTGACATCCCTGACCAGCCAAGGGTCTTCACCCTCACCACCTTTCACTCACATGAAACCATATACACAGACACTCCAGTTTTGTTTTTGCATGAAATTGTATCTCAGTCTAAGGTCTCATGCTGTTGCTGCTACTGTCTTACTATTATAGCAACCTTCAGAAGTAATTTCACAATCTTTGGGAGTCATGAGCCCATTGTTCATTTGTGCATCAAGTGTCATCTTTTGGTTTTTGGTTTTCCCTAGCAGTGAAGGCTAAATGAGATACACTGATTCTAGGTACATTGTTAACTTTCTAGGAGATAAATCAAGAACTAATTAGACTAAGAAGATTTAGTTTATATTTCTGAACAAGCAATTGTTGAAGGGTGGTGGTG

Numéro d'accès Ensembl | souris

ENSMUSG00000019699

Numéro d'accès NCBI

NP_035915

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... AKT3(23797) , Akt3(23797)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

X Qian et al.
Oncogene, 33(26), 3411-3421 (2013-08-27)
N-cadherin and HER2/neu were found to be co-expressed in invasive breast carcinomas. To test the contribution of N-cadherin and HER2 in mammary tumor metastasis, we targeted N-cadherin expression in the mammary epithelium of the MMTV-Neu mouse. In the context of
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique