Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU050191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTCCGAGGAGAGATGTTTGTCTTCAAGGAGCGATGGTTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAATTCTGGAGGGGCCTGCCTGCATCCATCAATACTGCCTACGAAAGGAAGGATGGCAAATTTGTCTTCTTCAAAGGAGATAAGCACTGGGTGTTTGACGAAGCCTCCCTGGAACCCGGGTACCCCAAGCACATTAAGGAGCTTGGCCGAGGGCTGCCCACGGACAAGATCGATGCAGCTCTCTTCTGGATGCCCAATGGGAAGACCTACTTCTTCCGGGGCAATAAGTACTACCGGTTCAATGAAGAATTCAGGGCAGTGGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGGGTCATTCATGGGCAGTGATG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them
Naohiko Koshikawa et al.
Cancer research, 75(16), 3327-3339 (2015-07-02)
Eph receptor tyrosine kinases are considered candidate therapeutic targets in cancer, but they can exert opposing effects on cell growth. In the presence of its ligands, Eph receptor EphA2 suppresses signaling by other growth factor receptors, including ErbB, whereas ligand-independent
Dane K Lund et al.
American journal of physiology. Cell physiology, 307(2), C140-C149 (2014-06-06)
The twenty-five known matrix metalloproteases (MMPs) and their endogenous inhibitors, tissue inhibitors of metalloproteases (TIMPs), mediate cell invasion through the extracellular matrix (ECM). In a comparative three-dimensional assay, we analyzed human and mouse satellite cells' competence to invade an artificial

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique