Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU024521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ucp2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCTGAGCTGGTGACCTATGACCTCATCAAAGATACTCTCCTGAAAGCCAACCTCATGACAGATGACCTCCCTTGCCACTTCACTTCTGCCTTCGGGGCCGGCTTCTGCACCACCGTCATCGCCTCCCCTGTTGATGTGGTCAAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCTCCGGAAGGAGGGACCCCGCGCCTTCTACAAGGGGTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAACGTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAATGGCTGCCTACCAATCTCGGGAGGCACCTTTCTGAGCCTCTCCATGCTGACCTGGACCCTGCTTCCCAGCCCTGCCCTGTCTTTTTCTTCATCCTCTGCCCAGTCCCATTCTCTTCCCATTTCCTGCAC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Emiko Kasahara et al.
Neuroimmunomodulation, 22(5), 279-292 (2015-06-16)
Although psychological and/or physiological stress has been well documented to influence immune responses, the precise mechanism for immunomodulation remains to be elucidated. The present work describes the role of the hypothalamic-pituitary-adrenal (HPA) axis in the mechanism of stress-mediated enhanced-resistance to
Guangsheng Yu et al.
Bioscience reports, 35(4) (2015-07-17)
Oxidative stress induction is a common effector pathway for commonly used chemotherapeutic agents like gemcitabine (GEM) in hepatocellular carcinoma (HCC) patients. However, GEM alone or in combination with oxiplatin hardly renders any survival benefits to HCC patients. Mitochondrial uncoupling protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique