Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU022451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gata2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGGAACGCCAACGGGGACCCTGTGTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACCCGGAATCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAATGTTTCGAGGAGCTCTCCAAGTGCATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGCCCTGGCTGGACACATGGCACCTGTGGGACACCTCCCACCTTTTAGTCACTCTGGACACATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTTTGGCCACCCCCACCCGTCCAGCATGGTGACTGCCATGGGCTAGGCAAGCCTCCCACTGGACAGACATGGACATCAAGGGTGGT

Numéro d'accès Ensembl | souris

ENSMUSG00000015053

Numéro d'accès NCBI

NM_008090

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GATA2(14461) , Gata2(14461)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Song Shen et al.
Molecular pharmaceutics, 11(8), 2612-2622 (2014-02-14)
Synthetic lethal interaction provides a conceptual framework for the development of wiser cancer therapeutics. In this study, we exploited a therapeutic strategy based on the interaction between GATA binding protein 2 (GATA2) downregulation and the KRAS mutation status by delivering
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique