Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU018341

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGCTTAGTCTTCCTCATCGCTGTGGTCGTCATTGCCATCGTATGTAACAGACGGGGGTTTGAGCGTGCCGACTCAGAGTACACGGACAAGCTACAACACTACACCAGCGGACACATGACCCCAGGCATGAAGATCTATATAGACCCTTTCACCTATGAAGATCCTAATGAGGCAGTGCGGGAGTTTGCCAAGGAAATTGACATCTCCTGTGTCAAGATTGAGCAGGTGATCGGAGCAGGGGAATTTGGTGAGGTCTGCAGTGGCCATTTGAAGCTGCCAGGCAAGAGAGAGATCTTTGTAGCCATCAAGACCCTCAAGTCAGGATACACGGAGAAACAGCGCCGGGACTTCCTGAGTGAGGCATCCATCATGGGCCAGTTCGACCACCCCAATGTCATCCATCTGGAAGGGGTTGTCACCAAGAGCACACCTGTC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Walaiporn Khansaard et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(10), 10031-10041 (2014-07-12)
The activation of Ephrin (Eph) receptors, the largest tyrosine kinase families of cell surface receptor, has recently been addressed in human cholangiocarcinoma (CCA). Therefore, the present study aimed to investigate the role of Eph receptors and its ligands in CCA.
Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Young Hyun Jung et al.
Biochimica et biophysica acta, 1853(8), 1905-1917 (2015-05-13)
The role of unsaturated fatty acids (UFAs) is essential for determining stem cell functions. Eph/Ephrin interactions are important for regulation of stem cell fate and localization within their niche, which is significant for a wide range of stem cell behavior.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique