Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU016141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Foxm1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGTTAAGCAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTTAAGGTTGAGGAGCCCTCAGGAGTGTCAACATCTTGGCAGGACTCTGTGTCTGAGAGGCCACCCTACTCTTATATGGCCATGATACAGTTTGCCATCAACAGCACTGAGAGAAAGCGCATGACCTTGAAGGACATCTACACTTGGATTGAGGACCACTTCCCTTACTTTAAGCACATTGCCAAGCCAGGCTGGAAGAACTCTATTCGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAGACATCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCCAATCGCTACTTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAATCGCCCGAGCACTTGGAATCACAGCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaoxiao Li et al.
Journal of translational medicine, 11, 204-204 (2013-09-06)
Forkhead box transcription factor 1 (FOXM1) has been reported to overexpress and correlate with pathogenesis in a variety of human malignancies. However, little research has been done to investigate its clinical significance in gastric cancer. We examined the expression of
KanKan Yang et al.
Journal of experimental & clinical cancer research : CR, 34, 40-40 (2015-05-04)
The Forkhead box M1 (FOXM1) is an oncogenic transcription factor and plays a significant role in cell EMT, proliferation, metastasis in a multitude of human solid tumors including colorectal cancer (CRC). However, the underlying molecular mechanisms by which FoxM1 contributes
Jiujie Cui et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(10), 2595-2606 (2014-03-19)
The transcription factor Forkhead box protein M1 (FOXM1) plays critical roles in cancer development and progression. However, the regulatory role and underlying mechanisms of FOXM1 in cancer metabolism are unknown. In this study, we characterized the regulation of aerobic glycolysis
Weihua Jiang et al.
International journal of clinical and experimental pathology, 8(6), 6756-6763 (2015-08-12)
The oncogenic transcription factor forkhead box protein M1 (FOXM1) plays critical roles in gastric cancer (GC) development and progression. However, the underlying mechanisms has not fully demonstrated. Lactate dehydrogenase A (LDHA) is widely overexpressed in a series of cancers and
Satoru Inoguchi et al.
FEBS letters, 588(17), 3170-3179 (2014-07-08)
Here, we found that microRNA-24-1 (miR-24-1) is significantly reduced in bladder cancer (BC) tissues, suggesting that it functions as a tumour suppressor. Restoration of mature miR-24-1 inhibits cancer cell proliferation and induces apoptosis. Forkhead box protein M1 (FOXM1) is a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique