Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU014271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Smad3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCCGTATGAGCTTCGTCAAAGGCTGGGGAGCAGAGTACAGGAGACAGACAGTGACCAGCACCCCCTGCTGGATTGAGCTACACCTGAATGGACCCTTGCAGTGGCTTGTCAAGGTCCTCACCCAGATGGGTTCCCCGAGCATCCGCTGTTCCAGTGTGTCTTAGAGACACTAGGAGTAAAGGGAGCGGGTTGGGGAGGGCGGGCTTGGGGAAAATGACCTTGGAAGAGAACTCCATCCAACTTGGTCTTGTCAAAGAACACCGATTCCACTCAACTAAGGCACCAGCCTGTTTCTGAGACCACAGAAGAAAACCCCAGGGATGGATTTATGAACAGCTGTGTCTGCTACATACACGTGCCCCTGTCTGAAGGCCAAGTGATGGCTTCTGTTCTGGTGGCTTGAACTAACAGGTGGTGTATCGCCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tianli Cheng et al.
International journal of oncology, 45(5), 1977-1988 (2014-09-02)
Altered expression of miRNAs contributes to development and progression of non-small cell lung cancer (NSCLC), while transforming growth factor-β (TGF-β) promotes NSCLC cell epithelial-mesenchymal transition. This study aimed to investigate the effects of TGF-β-induced miR‑143 expression in regulation of NSCLC
A Sakoguchi et al.
Clinical and experimental rheumatology, 32(6 Suppl 86) (2014-06-25)
The toll-like receptor (TLR) family is thought to be expressed in many cell types in the skin and play a role in various diseases. The expression pattern and role of TLRs in systemic sclerosis (SSc) is to be clarified. We

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique