Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU002961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pvrl1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCCATCTACAACCCGACTATGGGTGTGTCCGTGCTGCCTCCCTACGAGAAACGAGTGGAGTTCCTGCGACCCTCCTTCATCGACGGCACCATCCGCCTCTCCGGTCTGGAGCTGGAGGACGAGGGCATGTACATCTGTGAATTTGCCACCTTCCCTACGGGCAACCGTGAAAGCCAGCTCAATCTCACTGTGATGGCCAAACCCACCAACTGGATTGAGGGCACCCGGGCGGTGCTTCGAGCCAGGAAGGGACAGGATGACAAGGTTTTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGCGGTGTCCTGGGAAACACGGCTAAAGGGCGAGGCAGAGTACCAGGAAATTCGGAACCCCAATGGCACCGTGACAGTCATCAGCCGTTACCGTTT

Numéro d'accès Ensembl | souris

ENSMUSG00000032012

Numéro d'accès NCBI

NM_021424

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... PVRL1(58235) , Pvrl1(58235)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique