EHURLUC
MISSION® esiRNA
targeting RLUC
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Produits recommandés
Description
Powered by Eupheria Biotech
Niveau de qualité
Gamme de produits
MISSION®
Forme
lyophilized powder
Conditions d'expédition
ambient
Température de stockage
−20°C
Description générale
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Autres remarques
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Code de la classe de stockage
10 - Combustible liquids
Classe de danger pour l'eau (WGK)
WGK 1
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Certificats d'analyse (COA)
Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Les clients ont également consulté
Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results
Bram Piersma et al.
Cell and tissue research, 374(1), 165-175 (2018-05-05)
Mechanosensing of fibroblasts plays a key role in the development of fibrosis. So far, no effective treatments are available to treat this devastating disorder. Spectrins regulate cell morphology and are potential mechanosensors in a variety of non-erythroid cells, but little
Angela Russo et al.
Oncogene, 37(15), 1976-1990 (2018-01-26)
The signaling events involved in the onset of ovarian cancer from the fallopian tube epithelium (FTE) are crucial for early detection and treatment of the disease, but they remain poorly defined. Conditional homozygous knockout of PTEN mediated by PAX8-cre recombinase
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique