Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU157781

Sigma-Aldrich

MISSION® esiRNA

targeting human FLNA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qian Wang et al.
PloS one, 10(4), e0123018-e0123018 (2015-04-11)
Polycystin-2 (PC2), encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease. Filamins are actin-binding proteins implicated in scaffolding and membrane stabilization. Here we studied the effects of filamin on PC2 stability using filamin-deficient human
Alessandra Mingione et al.
Journal of molecular endocrinology, 58(2), 91-103 (2016-11-23)
Parathyroid tumors display reduced sensitivity to extracellular calcium ([Ca
E Peverelli et al.
Endocrinology, 155(8), 2932-2941 (2014-05-16)
Somatostatin receptor type 2 (SST2) is the main pharmacological target of medical therapy for GH-secreting pituitary tumors, but molecular mechanisms regulating its expression and signaling are largely unknown. The aim of this study was to investigate the role of cytoskeleton
R Catalano et al.
Cancer letters, 497, 77-88 (2020-10-20)
Adrenocortical carcinomas (ACCs) overexpress insulin-like growth factor 2 (IGF2), that drives a proliferative autocrine loop by binding to IGF1R and IR, but IGF1R/IR-targeted therapies failed in ACC patients. The cytoskeleton actin-binding protein filamin A (FLNA) impairs IR signalling in melanoma
Rosalinda M Savoy et al.
Endocrine-related cancer, 22(3), 369-386 (2015-03-12)
Prostate cancer (PCa) progression is regulated by the androgen receptor (AR); however, patients undergoing androgen-deprivation therapy (ADT) for disseminated PCa eventually develop castration-resistant PCa (CRPC). Results of previous studies indicated that AR, a transcription factor, occupies distinct genomic loci in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique