Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU157031

Sigma-Aldrich

MISSION® esiRNA

targeting human NES

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAGGCAGAGCTGAATCTGAGGGAGCAGGATGGCTTCACTGGGAAGGAGGAGGTGGTAGAGCAGGGAGAGCTGAATGCCACAGAGGAGGTCTGGATCCCAGGCGAGGGGCACCCAGAGAGCCCTGAGCCCAAAGAGCAGAGAGGCCTGGTTGAGGGAGCCAGTGTGAAGGGAGGGGCTGAGGGCCTCCAGGACCCTGAAGGGCAATCACAACAGGTGGGGGCCCCAGGCCTCCAGGCTCCCCAGGGGCTGCCAGAGGCGATAGAGCCCCTGGTGGAAGATGATGTGGCCCCAGGGGGTGACCAAGCCTCCCCAGAGGTCATGTTGGGGTCAGAGCCTGCCATGGGTGAGTCTGCTGCGGGAGCTGAGCCAGGCCCGGGGCAGGGGGTGGGAGGGCTGGGGGACCCAGGCCATCTGACCAGGGAAGAGGTGATGGAACCACCCCTGGAAGAGGAGAGTTTGGAGGCAAAGAGGGT

Numéro d'accès Ensembl | humain

ENSG00000132688

Numéro d'accès NCBI

NM_006617

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NES(10763) , NES(10763)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xu Yang et al.
Kidney & blood pressure research, 43(2), 616-627 (2018-04-25)
Preeclampsia (PE) is a pregnancy-specific hypertensive disorder that is characterised by a high incidence of hypertension and proteinuria. Podocytes are involved in the formation of a split membrane, which is the last barrier preventing the leakage of protein into the
Yasuhiro Shinkai et al.
Nucleic acid therapeutics, 27(3), 168-175 (2017-03-30)
Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Kim Tardif et al.
American journal of physiology. Heart and circulatory physiology, 308(10), H1265-H1274 (2015-03-15)
Proliferation and hypertrophy of vascular smooth muscle cells represent hallmark features of vessel remodeling secondary to hypertension. The intermediate filament protein nestin was recently identified in vascular smooth muscle cells and in other cell types directly participated in proliferation. The

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique