Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU156781

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGAGGTCATTACGCTCTTCACTGGGGTCCTGTTCTTCTTCACCAACATCAAAGACTTGTTCATGAAGAAATGCCCTGGAGTGAATTCTCTCTTCATTGATGGCTCCTTCCAGCTGCTCTACTTCATCTACTCTGTCCTGGTGATCGTCTCAGCAGCCCTCTACCTGGCAGGGATCGAGGCCTACCTGGCCGTGATGGTCTTTGCCCTGGTCCTGGGCTGGATGAATGCCCTTTACTTCACCCGTGGGCTGAAGCTGACGGGGACCTATAGCATCATGATCCAGAAGATTCTCTTCAAGGACCTTTTCCGATTCCTGCTCGTCTACTTGCTCTTCATGATCGGCTACGCTTCAGCCCTGGTCTCCCTCCTGAACCCGTGTGCCAACATGAAGGTGTGCAATGAGGACCAGACCAACTGCACAGTGCCCACTTACCCCTCGTGCCGTGACAGCGAGACCTTCAGCACCTTCCTCCTGGACCTGTT

Numéro d'accès Ensembl | humain

ENSG00000111199

Numéro d'accès NCBI

NM_021625

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TRPV4(59341) , TRPV4(59341)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuanzheng Gu et al.
The Journal of cell biology, 216(7), 2179-2199 (2017-06-14)
Little is known about mechanical regulation of morphological and functional polarity of central neurons. In this study, we report that mechanical stress specifically induces varicosities in the axons but not the dendrites of central neurons by activating TRPV4, a Ca
Hengli Zhao et al.
Frontiers in molecular neuroscience, 11, 97-97 (2018-04-11)
Blood-brain barrier (BBB) disruption and subsequent brain edema play important roles in the secondary neuronal death and neurological dysfunction that are observed following intracerebral hemorrhage (ICH). In previous studies, transient receptor potential vanilloid 4 (TRPV4), a calcium-permeable mechanosensitive channel, was
Bo Xu et al.
Life sciences, 228, 158-166 (2019-05-06)
Chondrocyte apoptosis is the most common pathological feature of cartilage in osteoarthritis (OA). Excessive mechanical stress can induce chondrocyte apoptosis and destroy cartilage tissue. Transient receptor potential channel vanilloid 4 (TRPV4) is a mechanosensitive ion channel that mediates chondrocyte response
Boran Cao et al.
Journal of cellular physiology, 234(5), 6831-6841 (2018-11-06)
The aim of this study is to evaluate the effect of transient receptor potential vanilloid 4 (TRPV4) on osteoclast differentiation and osteoporosis, and to investigate the underlying mechanism. The results showed that TRPV4 expression and intracellular Ca2+ concentration were significantly
Tatsuya Ihara et al.
Neurourology and urodynamics, 37(8), 2535-2543 (2018-08-15)
The sensation of bladder fullness (SBF) is triggered by the release of ATP. Therefore, the aim of this study was to investigate whether time-dependent changes in the levels of stretch-released ATP in mouse primary-cultured urothelial cells (MPCUCs) is regulated by
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique