Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU155971

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGTGTTCAAGGACCATCCCCAGGGCACAGAACCTGATATGTACAAATATGATGCCTATTTGTGCTTCAGCAGCAAAGACTTCACATGGGTGCAGAATGCTTTGCTCAAACACCTGGACACTCAATACAGTGACCAAAACAGATTCAACCTGTGCTTTGAAGAAAGAGACTTTGTCCCAGGAGAAAACCGCATTGCCAATATCCAGGATGCCATCTGGAACAGTAGAAAGATCGTTTGTCTTGTGAGCAGACACTTCCTTAGAGATGGCTGGTGCCTTGAAGCCTTCAGTTATGCCCAGGGCAGGTGCTTATCTGACCTTAACAGTGCTCTCATCATGGTGGTGGTTGGGTCCTTGTCCCAGTACCAGTTGATGAAACATCAATCCATCAGAGGCTTTGTACAGAAACAGCAGTATTTGAGGTGGCCTGAGGATTTCCAGGATGTTGGCTGGTTTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li-Juan Ji et al.
Journal of cellular biochemistry, 119(1), 1017-1026 (2017-07-08)
MicroRNAs (miRNAs) are reported as vital participators in the pathophysiological course of neuropathic pain. However, the underlying mechanisms of the functional roles of miRNAs in neuropathic pain are largely unknown. This study was designed to explore the potential role of
Signaling Mediated by Toll-
Maria Del Mar Cendra et al.
Frontiers in cellular and infection microbiology, 7, 130-130 (2017-05-05)
Tanay Bhatt et al.
Cell reports, 29(9), 2546-2555 (2019-11-28)
Antimicrobial peptides (AMPs) are the body's natural innate immune defense against a spectrum of pathogens and can also modulate cell proliferation, chemotaxis, angiogenesis, wound healing, and immune cell activity. Harnessing these diverse functions for prophylactic use is contingent upon understanding

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique